Suchergebnisse
Results list
Land use/cover dynamics in Austin metropolitan area since 1992
The present dataset is part of the published scientific paper Zhao C, Weng Q, Hersperger A M. Characterizing the 3-D urban morphology transformation to understand urban-form dynamics: a case study of Austin, Texas, USA. Landscape and urban planning, 2020, 203:103881. The overall objective of this paper is to understand urban form dynamics in the Austin metropolitan area for the periods 2006–2011 and 2011–2016. The study also aims to understand to what extent the changes in the built environment (in terms of ‘efficient growth’ versus ‘inefficient growth’) from the 1990s to 2016 in the Austin metropolitan area corresponded with ‘compact and efficient growth’ planning policy documents. The UMT distribution can be found in the paper. The area of transitioning UMT was provided in Table 2 and Table 3 can be found in the Appendix of the paper. A protocol was developed to perform the content analysis of the strategic plans and gather the data. The detailed list of protocol items can be found in Appendix B of the paper. This study demonstrates the advantage of applying Lidar data to characterize 3-D urban morphology type (UMT) transition and understand its dynamics, which helps develop a comprehensive understanding of the urbanization process and provides a tool for planning intentions and policies evaluation on urban development over time. The UMT maps can be found in Appendix A of the paper. The Lidar point datasets and the 30 × 30 m National Land Cover Database (NLCD) are the two main data sources of UMT mapping. Lidar datasets were gathered from different projects that had been conducted and collected by state agencies and other organizations between 2007 and 2017. Table A1 in the appendix in the paper shows the accuracies and acquisition parameters of the Lidar projects from 2007 to 2017. Land use/cover dynamics in Austin metropolitan area dataset provides Land use/cover patterns in the years 1992, 2001, 2004, 2006, 2008, 2011, 2013, 2016 with a spatial resolution of 30 meters. Since NLCD 1992 used a different classification system for the urban land classes, we first reclassified the NLCD 1992 using a customized Arcpy package.
Production de biogaz à partir d’engrais de ferme en Suisse
L'objectif de ce livre blanc est de fournir aux décideurs, aux administrations et aux parties prenantes les résultats de recherche les plus récents afin de promouvoir l'utilisation optimale de la bioénergie issue des engrais de ferme dans la transition énergétique suisse. A cette fin, les résultats du centre de compétence suisse pour la recherche en bioénergie - SCCER BIOSWEET - sont résumés et présentés dans un contexte plus large. Si rien d'autre n'est mentionné, les résultats se réfèrent à la Suisse et, dans le cas de la matière première, aux potentiels nationaux de biomasse.
High resolution global standardized drought indices
The dataset consists of the standardized precipitation (SPI) and the standardized precipitation evapotranspiration index (SPEI) index with a 30 arcsec (~1km) horizontal resolution. Data for precipitation rates (pr) and potential evapotranspiration (pet) are taken from CHELSA V2.1 (https://doi.org/10.16904/envidat.228.v2.1). Both data sets are monthly time series from 1980 to 2018 at 30 arcsec. and have the unit of kg m-2 month-1. SPEI is a more reliable measure of drought than SPI as it additionally considers the effect of potential evapotranspiration. Potential evapotranspiration (pet) is the amount of water per area per time that can evaporate at the soil surface or be transpired by plants in absence of water supply limitations. SPEI effectively estimates for a given location how the climatic water balance, i.e., the difference between precipitation rate (pr) and potential evapotranspiration (pet), relates to the long-term mean. Here, pet was calculated with the Penman-Montheith approach, assuming surface conductance of a reference crop of 12 cm height following the definition of the Food and Agriculture Organization of the United Nations (FAO), originating from CHELSA-BIOCLIM+ database (https://www.doi.org/10.16904/envidat.332). To obtain global time series of SPEI, in each pixel the frequency distribution of water balance estimates (pr-pet) is approximated with a log-logistic probability distribution function. We calculate monthly SPEI using a 12-month memory and approximate the parameters of the log-logistic probability distribution based on the time series from 1980-2018. Such a 12-month time window is suitable to capture long-term drought events that are long enough to impose substantial impacts on agriculture, hydrology, and ecosystems while ones at shorter time scales would be more appropriate to detect short-term drought. For each month, SPEI is calculated considering the respective water-balance value and the values of the eleven preceding months. Here we use SPEI-12 in December to represent the overall water-balance condition of the respective year. The resulting SPEI data has a horizontal resolution of 130 arcsec (~1km). The calculation of SPI and SPEI is done in R with the package SPEI (https://www.doi.org/10.32614/CRAN.package.SPEI).
Defoliation-Growth data
Using a literature review extracted data from 26 published papers which had data on individual tree defoliation and growth relationships In Europe. This data set includes 415 defoliation-growth data points from 16 different tree species covering 15+ countries in Europe. Growth metrics used in individual papers were different, and included increments in terms of volume, tree rings width, radial growth, basal area and biomass. All growth metrics were converted into relative growth (presented in this dataset), expressed as a percentage of the growth of progressively defoliated trees in relation to the growth of those trees adopted as reference (control) defoliation level (i.e. the growth of the lowest defoliation level in each study was used as the reference growth point).
Simulation parameters and outputs for towards a physically and microstructure-based equation for the evolution of the specific surface area in snow
In the associated study [1], evolution of randomly generated bi-continuous microstructures that resemble real snow microstructures has been investigated. The control of the ambient conditions (temperature and temperature gradient) and of the physical processes at play on the rate of change of the specific surface area have been evaluated. Based on the evaluation, a new physically-informed governing law for the coarsening of microstructures has been proposed. This law accurately predicts the simulation outputs under various conditions. Furthermore, a potential parametrization of newly introduced material properties has been proposed and evaluated on snow coarsening data. This dataset contains the parameters used for the mesh generation and the finite-element simulations. The output parameters of simulations, such as the ice fraction, surface of the ice-air interface per total volume, mean curvature and growth rate are provided. [1]: A.Braun, K. Fourteau, S. Frei, M. Lehning, H. Löwe: Towards a physically and microstructure-based equation for the evolution of the specific surface area in snow, Journal of Glaciology, accepted for publication in 2024
Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord
This dataset contains the raw environmental DNA data associated with the publication *Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord* in the journal Polar Biology (2023). Methods **Sampling** We sampled the Lilliehöök fjord on the west coast of Spitsbergen (Svalbard, Norway) over 3 days from 3 to 5 of August 2021. Samples were taken from the glacier front up to the fjord mouth of the Krossfjorden system, around 30 km long, after the Lilliehöök fjord merged with the mouth of Möller fjord. The fjord’s maximum depth has been recorded at 373 m (Svendsen et al. 2002) and has no sill at its entrance, thereby facilitating water exchange with the open ocean of the West Spitsbergen Current. We used a research vessel to sample 5 sites for a total of 15 samples, sampling 3 depths per site (3-m, chlorophyll a maximum and 85-m, unless sea floor was shallower). Shallow and intermediate samples between 3-m and 12-m represent ~35-L of water filtered in-situ using long tubing and a peristaltic pump, and all other deeper samples were taken from a total of 3 Niskin bottles (General Oceanics), representing 22-L of water sampled per sample. Water was filtered through a VigiDNA filtration capsule (SPYGEN) with a 0.20-µm pore size using an Athena peristaltic pump (Proactive Environmental Products, Bradenton, Florida) with a flow rate of ~1-L/min. Each sample was handled with single use tubing and gloves. **Molecular** To perform the amplification, we used two sets of primers: teleo (forward: ACACCGCCCGTCACTCT, reverse: CTTCCGGTACACTTACCATG; Valentini et al. 2016) and the universal eukaryotic 1389F/1510R primer pair, amplifying the V9-18S rDNA gene (Amaral-Zettler et al. 2009) (forward: TTGTACACACCGCCC, reverse: CCTTCYGCAGGTTCACCTAC). Data content: + Metabarcoding data: This zip file contains the 2 sequencing libraries filtered to only retain the samples used in the present study. + Code, data and figure: This zip file contains all data and code to reproduce the figures and the analysis in the study, with an associated README explaining the content of each folder. Additional informations For more details, please see the Methods in the associated publication: DOI: 10.1007/s00300-023-03187-9.
Impulse response functions for nonlinear nonstationary and heterogeneous systems
The R script IRFnnhs.R, which efficiently estimates impulse response functions for environmental systems that are nonlinear, nonstationary, or heterogeneous, based on their input and output time series. Scripts and results for a series of benchmark tests are also provided, to accompany Kirchner, J.W., Impulse response functions for heterogeneous, nonstationary, and nonlinear systems, estimated by deconvolution and demixing of noisy time series, _Sensors_, 22(9), 3291, https://doi.org/10.3390/s22093291, 2022.
Life at chilly temperatures - A collection of microorganisms from extreme habitats
The cold habitats of the Swiss Alps and the Arctic are undergoing change and are at risk of disappearing completely or partially in the future. Along with them, a poorly known diversity of microorganisms that have adapted to life in these supposedly hostile places. By cryopreserving microorganisms from these habitats, some of today's biodiversity can be preserved in biobanks. The collection contains cryopreserved bacteria and fungi isolated from permafrost and active layer of Muot da Barba Peider and Val Lavirun, from the glacier forefield and glacier toe of the Damma glacier, from active layer in northern Greenland and from plastic waste in Svalbard, as well as isolates from plastic incubations in Muot da Barba Peider, northern Greenland and arctic Russian soils. Project overview: https://www.wsl.ch/en/projects/life-at-chilly-temperatures-a-collection-of-microorganisms-from-extreme-habitats/
Snow depth mapping by lidar station Braemabuel
We developed a monitoring system using low-cost lidar (Livox Avia) and optical sensors, to measure snow depth variations in an avalanche release area at a high spatiotemporal scale (centimeter to low decimeter spatial resolution and hourly temporal resolution). A detailed description of the setup and a first data analysis is published in: [Ruttner-Jansen, P., Voordendag, A., Hartmann, T., Glaus, J., Wieser, A., & Bühler, Y. (2024). Monitoring snow depth variations in an avalanche release area using low cost lidar and optical sensors. EGUsphere, 2024, 1-20.](https://nhess.copernicus.org/articles/25/1315/2025/) This dataset contains hourly 3D lidar data of the snow surface at the test site Braemabuel in Davos, Switzerland from the winter season 2023-2024 (23.11.2023 - 14.04.2024). Braema1 is installed at 2191 m a.s.l. in the slope, looking up into the avalache release area, and Braema2 is installed at 2255 m a.s.l at the ridge, looking down. Both scans together cover an area of about 15000 m². The data is in format ".las" and contains the points in XYZ [m], in the scanner own coordinate system - scalar fields: intensity, return number, timestamp, tag, label -- tag: binary code from Livox (see [Livox Avia Manual](https://terra-1-g.djicdn.com/65c028cd298f4669a7f0e40e50ba1131/Download/Avia/Livox%20Avia%20User%20Manual%20202204.pdf)) -- label: marking outliers (filtered by distance and SOR to get snow particles in the air)
Data reliability study: avalanche size estimates and outlines
This dataset contains the data used and collected to investigate the reliability of avalanche size estimates and avalanche outlines (see related publications). Namely this is Avalanche size estimates * the 10 pictures depicting avalanches * the survey results from the 170 participants Avalanche outlines mapped from oblique photographs * the pictures of the six avalanches * the avalanche outlines mapped by the 10 participants * the reference mapped from the georeferenced photographs Avalanche outlines from remotely-sensed imagery * the orthophotos in the four different resolutions (2m, 1m, 50cm, 25cm) * the area of interest (AoI) delimiting the research area * the avalanche mappings in each resolution for all five participants * the shade masks used to separate illuminated and shaded areas The acquisition of the orthophotos has been partially supported by the Swiss National Science Foundation (SNF; Grant N°200021_172800).